Dystrobrevin alpha (DTNA) (NM_001392) Human 3' UTR Clone

CAT#: SC203714

3`UTR clone of dystrobrevin alpha (DTNA) transcript variant 7 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DTNA"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DTNA
Synonyms D18S892E; DRP3; DTN; DTN-A; LVNC1
ACCN NM_001392
Insert Size 255 bp
Sequence Data
>SC203714 3'UTR clone of NM_001392
The sequence shown below is from the reference sequence of NM_001392. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTGCTTTTGGTGGATGCGTCTAGATGGATAACATGACTTCTTCTACCCTAAAATATTCCTATAATACTTT
GAGCTGTTCTGGTTCCTCCAGGGTGCATGGTACCCATTAACCCAAAATATGATTATTTCCCTTTTTTCCC
ATTTTCAGTCATTTTGGAATGTTCTCTGTGAACCACAGTTGTGTTGTTTAAAGCTCACATTTCTTTCTGT
CACCACAGAGATTGGCCTACGGTTTCTGTTTTGAGGGTGCTGTTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001392.4
Summary 'The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]'
Locus ID 1837

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.