HAO2 (NM_001005783) Human 3' UTR Clone

CAT#: SC203722

3`UTR clone of hydroxyacid oxidase 2 (long chain) (HAO2) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HAO2
• Synonyms: GIG16; HAOX2
• ACCN: NM_001005783
• Insert Size: 280
• Sequence Data:
  Insert Sequence

  >SC203722 3'UTR clone of NM_001005783
  The sequence shown below is from the reference sequence of NM_001005783. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAGTTTTCCAGGCTGTAAGAAAAAAGGGCCAATAACCAGACTGCTGAGGTTGCCCACAGGAGGATCACA
  AACTCACAGCACAGTGTGTGATGCTGTCCTTCCTGGACCCCATTCTGTCCGGAGGCTCATGGCCCATATT
  TCCCACATTTCTAATACCACCACCCCTGTGCTTCAGGCCCTCCAAACCCCTGTGTTCCCCAAATGTTCCA
  TGCCCTTCTTTGTATCACTGACTATTATATGTTGCTCTCTTGCCTAAATCTTCCTCTGAAGTAAAAGATC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001005783.1
• Summary: This gene is one of three related genes that have 2-hydroxyacid oxidase activity. The encoded protein localizes to the peroxisome has the highest activity toward the substrate 2-hydroxypalmitate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
• Locus ID: 51179