SIN1 (MAPKAP1) (NM_001006618) Human 3' UTR Clone

CAT#: SC203732

3`UTR clone of mitogen-activated protein kinase associated protein 1 (MAPKAP1) transcript variant 6 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAPKAP1
• Synonyms: JC310; MIP1; SIN1; SIN1b; SIN1g
• ACCN: NM_001006618
• Insert Size: 299
• Sequence Data:
  Insert Sequence

  >SC203732 3'UTR clone of NM_001006618
  The sequence shown below is from the reference sequence of NM_001006618. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCCAGAAAGTTTCAGGTGCTTGTGACTAAATTCACTAATTTCACTGGCTGTCAAGGCTGTGTTAAGGAAA
  ATGGGTTTGAACTGCTGTGGGTTTTGAGTACTGGACTGGATGTCAGAAACCTTTGCCATCACGGGAAATT
  CTGTCACTCTGGATTTACTGTCTGTTCCCCACAGCTAAATTCCTCTGCAGTGTGATTTAGCACCCTGGAT
  CCCCATCAACCAGTTTTGGCATTTATTTGAATGCATTACCCCACTGGTTTCCATAAACTATTTTACAATT
  GTTTAAAATAAATGACTGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001006618.1
• Summary: This gene encodes a protein that is highly similar to the yeast SIN1 protein, a stress-activated protein kinase. Alternatively spliced transcript variants encoding distinct isoforms have been described. Alternate polyadenylation sites as well as alternate 3' UTRs have been identified for transcripts of this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 79109