NT5C (NM_014595) Human 3' UTR Clone

CAT#: SC203744

3`UTR clone of 5' 3'-nucleotidase cytosolic (NT5C) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NT5C
• Synonyms: cdN; DNT; dNT-1; DNT1; HEL74; P5N2; PN-I; PN-II; UMPH2
• ACCN: NM_014595
• Insert Size: 267
• Sequence Data:
  Insert Sequence

  >SC203744 3'UTR clone of NM_014595
  The sequence shown below is from the reference sequence of NM_014595. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTTAGATAGCAAGCGCGGAGCTGCGCAGCGGGAATGAGCGGGGATGCCGCGGGCAGCAGCTGGAGCTAAA
  GGAAGGGCAGGCCCACAGGGGCCACCGCAGAGCCGAGTCGGGGCGGCATCGTGCTGGTGCCTCTGGCCCC
  GTGGAGTGGAGCAGGCAGACACCGTTAAGCGCTGTGCTACCGGGCCCCAGGCCCAGCCACCCGGTACCTC
  CCGAGAGGCTGTCCCTGGACCCTGGCTGGCATGGAAATACAGTGGGAAAACCAGTCG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014595.1
• Summary: This gene encodes a nucleotidase that catalyzes the dephosphorylation of the 5' deoxyribonucleotides (dNTP) and 2'(3')-dNTP and ribonucleotides, but not 5' ribonucleotides. Of the different forms of nucleotidases characterized, this enzyme is unique in its preference for 5'-dNTP. It may be one of the enzymes involved in regulating the size of dNTP pools in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2011]
• Locus ID: 30833