Glutathione S Transferase kappa 1 (GSTK1) (NM_001143680) Human 3' UTR Clone

CAT#: SC203809

3`UTR clone of glutathione S-transferase kappa 1 (GSTK1) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GSTK1
• Synonyms: GST; GST13; GST 13-13; GST13-13; GSTK1-1; hGSTK1
• ACCN: NM_001143680
• Insert Size: 305
• Sequence Data:
  Insert Sequence

  >SC203809 3'UTR clone of NM_001143680
  The sequence shown below is from the reference sequence of NM_001143680. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATACCTCCAGCCGTGAATGCCAGACTTTAAGATTGCCCGGAGGAAGCAAACTCTTCGTATAAAAAAAGCA
  GGCCATCTGCTTAACCCTTGGCTCCACCATAAGGCACTGGGACTCGGATTTCTCTATCTGATAGAGGTAT
  TTTCTGTGGCCCTGGGAGCTGTCTGTCTTTCCCCTACCCCCAAGGATGCCAGGAAGACGTCCACCATTAG
  CCATGTGGCAACCTTTACTTCTATGCCTCACAAGTGCCTTTCAGAGAGCCCCAATTCTGCTTTCCCACAA
  AATAAACCTAATGCCATCAGGCAAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001143680.1
• Summary: This gene encodes a member of the kappa class of the glutathione transferase superfamily of enzymes that function in cellular detoxification. The encoded protein is localized to the peroxisome and catalyzes the conjugation of glutathione to a wide range of hydrophobic substates facilitating the removal of these compounds from cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
• Locus ID: 373156