BCCIP (NM_078468) Human 3' UTR Clone

CAT#: SC203821

3`UTR clone of BRCA2 and CDKN1A interacting protein (BCCIP) transcript variant B for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BCCIP
• Synonyms: TOK-1; TOK1
• ACCN: NM_078468
• Insert Size: 306
• Sequence Data:
  Insert Sequence

  >SC203821 3'UTR clone of NM_078468
  The sequence shown below is from the reference sequence of NM_078468. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAACGAAATCATGGATAAACTGAAAGAATATCTATCTGTCTAACCCATTTCCAATGGACAGTGATGGGCT
  TGTTTTTGTAAAATTACCAGAAAACTCAGTGGAGATTTACTGAAAAACTCAGACTTTATTCAGATTAAGT
  TCCTCTACAAAAAGTAGGGTTCTGTCCCATGTGTCTCTGACACATTTACAAAATACCAGTTTTTTAAAAT
  TTTGGTCAAATTATGAGTGGTTGATTTAAAAACTTTTCCAAGAAGAAGAAAAGCATGGAGTAGTAATTTA
  AAGAACTCAATAAAAACTTCTATTTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_078468.2
• Summary: This gene product was isolated on the basis of its interaction with BRCA2 and p21 proteins. It is an evolutionarily conserved nuclear protein with multiple interacting domains. The N-terminal half shares moderate homology with regions of calmodulin and M-calpain, suggesting that it may also bind calcium. Functional studies indicate that this protein may be an important cofactor for BRCA2 in tumor suppression, and a modulator of CDK2 kinase activity via p21. This protein has also been implicated in the regulation of BRCA2 and RAD51 nuclear focus formation, double-strand break-induced homologous recombination, and cell cycle progression. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 56647