C11orf51 (ANAPC15) (NM_014042) Human 3' UTR Clone

CAT#: SC203824

3`UTR clone of chromosome 11 open reading frame 51 (C11orf51) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ANAPC15"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ANAPC15
Synonyms APC15; C11orf51; HSPC020
ACCN NM_014042
Insert Size 305
Sequence Data
>SC203824 3'UTR clone of NM_014042
The sequence shown below is from the reference sequence of NM_014042. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATGGAAGGCAACGAACAGGATCAGGACCAGTGGATGATCTAGGTAGACAAGGCAGGGTGGCCTCAGGGAG
ATTCCAGGCCAGCCCAAACTACCCTGCATCCCAACCCCCAACCCCTGCCCACAGAACCAGCTGATGGCCC
CAGTGCCTGAAAGTGCCCTTGGGCACCTCCTCAGCTGCTGCCAGGATCTGGTCTCTTTGGCCCCTCCCAG
GCCATCAGTCTGCACTTGAAATCCCCAGGGCCTGAAACCTACTCCACCTTCCTGGCCAGTACCTCACCCC
TTGATTGCCAGGTCTGGTCTAAGTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014042.2
Locus ID 25906

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.