SNRPB (NM_003091) Human 3' UTR Clone

CAT#: SC203838

3`UTR clone of small nuclear ribonucleoprotein polypeptides B and B1 (SNRPB) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SNRPB
• Synonyms: CCMS; COD; Sm-B/B'; SmB/B'; SmB/SmB'; snRNP-B; SNRPB1
• ACCN: NM_003091
• Insert Size: 286 bp
• Sequence Data:
  Insert Sequence

  >SC203838 3'UTR clone of NM_003091
  The sequence shown below is from the reference sequence of NM_003091. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGATGCGAGGCCTTCTTTGACCCTTGGCCACAGAGTATGGAAGTAGCTCCGCAGAGGCGTGGGCTCGATT
  CCTCAGGGCCACGTTACCACAGACCTGTTTGTTTCTTATGCTGTTGTTCGTGGAGTCTCATGGGATTGTC
  TGGTTTCCCTTACAGGGCCCCCTCCCCCGGGAATGCGCCCACCAAGGCCCTAGACTCATCTTGGCCCTCC
  TCAGCTCCCTGCCTGTTTCCCGTAAGGCTGTACATAGTCCTTTTATCTCCTTGTGGCCTATGAAACTGGT
  TTATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003091.3
• Summary: 'The protein encoded by this gene is one of several nuclear proteins that are found in common among U1, U2, U4/U6, and U5 small ribonucleoprotein particles (snRNPs). These snRNPs are involved in pre-mRNA splicing, and the encoded protein may also play a role in pre-mRNA splicing or snRNP structure. Autoantibodies from patients with systemic lupus erythematosus frequently recognize epitopes on the encoded protein. Two transcript variants encoding different isoforms (B and B') have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 6628