TUSC3 (NM_178234) Human 3' UTR Clone

CAT#: SC203839

3`UTR clone of tumor suppressor candidate 3 (TUSC3) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TUSC3
• Synonyms: D8S1992; M33; MagT2; MRT7; MRT22; N33; OST3A; SLC58A2
• ACCN: NM_178234
• Insert Size: 286
• Sequence Data:
  Insert Sequence

  >SC203839 3'UTR clone of NM_178234
  The sequence shown below is from the reference sequence of NM_178234. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCCAAGTACCACGGCTATCCTTATAGCTTTTTAATTAAATGAAGCCAAGTGGGATTTGCATAAAGTGAAT
  GTTTACCATGAAGATAAACTGTTCCTGACTTTATACTATTTTGAATTCATTCATTTCATTGTGATCAGCT
  AGCTTATTCTTGTGTACTTTTTTTAAACTGTGGGTTTTCCTAGTAAATTTAATTTACAGAAATCAATGGT
  AGCATTTAGTAATCTACAAAGGAAATATCAAAGTGTTTTTCAAGCCTGTTATATTCAGTGTGTGCCACAG
  GATTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_178234.1
• Summary: This gene encodes a protein that has been associated with several biological functions including cellular magnesium uptake, protein glycosylation and embryonic development. This protein localizes to the endoplasmic reticulum and acts as a component of the oligosaccharyl transferase complex which is responsible for N-linked protein glycosylation. This gene is a candidate tumor suppressor gene. Homozygous mutations in this gene are associated with autosomal recessive nonsyndromic mental retardation-7 and in the proliferation and invasiveness of several cancers including metastatic pancreatic cancer, ovarian cancer and glioblastoma multiform. [provided by RefSeq, Oct 2017]
• Locus ID: 7991