NR1D1 (NM_021724) Human 3' UTR Clone

CAT#: SC203850

3`UTR clone of nuclear receptor subfamily 1 group D member 1 (NR1D1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NR1D1
• Synonyms: ear-1; EAR1; hRev; REVERBA; REVERBalpha; THRA1; THRAL
• ACCN: NM_021724
• Insert Size: 319
• Sequence Data:
  Insert Sequence

  >SC203850 3'UTR clone of NM_021724
  The sequence shown below is from the reference sequence of NM_021724. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCATTCCGAGAAGCTGCTGTCCTTCCGGGTGGACGCCCAGTGACCCGCCCGGCCGGCCTTCTGCCGCTG
  CCCCCTTGTACAGAATCGAACTCTGCACTTCTCTCTCCTTTACGAGACGAAAAGGAAAAGCAAACCAGAA
  TCTTATTTATATTGTTATAAAATATTCCAAGATGAGCCTCTGGCCCCCTGAGCCTTCTTGTAAATACCTG
  CCTCCCTCCCCCATCACCGAACTTCCCCTCCTCCCCTATTTAAACCACTCTGTCTCCCCCACAACCCTCC
  CCTGGCCCTCTGATTTGTTCTGTTCCTGTCTCAAATCCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_021724.2
• Summary: This gene encodes a transcription factor that is a member of the nuclear receptor subfamily 1. The encoded protein is a ligand-sensitive transcription factor that negatively regulates the expression of core clock proteins. In particular this protein represses the circadian clock transcription factor aryl hydrocarbon receptor nuclear translocator-like protein 1 (ARNTL). This protein may also be involved in regulating genes that function in metabolic, inflammatory and cardiovascular processes. [provided by RefSeq, Jan 2013]
• Locus ID: 9572