SDHA (NM_004168) Human 3' UTR Clone

CAT#: SC203858

3`UTR clone of succinate dehydrogenase complex subunit A flavoprotein (Fp) (SDHA) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SDHA
• Synonyms: CMD1GG; FP; PGL5; SDH1; SDH2; SDHF
• ACCN: NM_004168
• Insert Size: 297 bp
• Sequence Data:
  Insert Sequence

  >SC203858 3'UTR clone of NM_004168
  The sequence shown below is from the reference sequence of NM_004168. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGCCATTCGCTCCTACTGATGAGACAAGATGTGGTGATGACAGAATCAGCTTTTGTAATTATGTATAAT
  AGCTCATGCATGTGTCCATGTCATAACTGTCTTCATACGCTTCTGCACTCTGGGGAAGAAGGAGTACATT
  GAAGGGAGATTGGCACCTAGTGGCTGGGAGCTTGCCAGGAACCCAGTGGCCAGGGAGCGTGGCACTTACC
  TTTGTCCCTTGCTTCATTCTTGTGAGATGATAAAACTGGGCACAGCTCTTAAATAAAATATAAATGAACA
  AACTTTCTTTTATTTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004168.2
• Summary: 'This gene encodes a major catalytic subunit of succinate-ubiquinone oxidoreductase, a complex of the mitochondrial respiratory chain. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. Mutations in this gene have been associated with a form of mitochondrial respiratory chain deficiency known as Leigh Syndrome. A pseudogene has been identified on chromosome 3q29. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]'
• Locus ID: 6389