SDHA (NM_004168) Human 3' UTR Clone

CAT#: SC203858

3`UTR clone of succinate dehydrogenase complex subunit A flavoprotein (Fp) (SDHA) nuclear gene encoding mitochondrial protein for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SDHA"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SDHA
Synonyms CMD1GG; FP; PGL5; SDH1; SDH2; SDHF
ACCN NM_004168
Insert Size 297 bp
Sequence Data
>SC203858 3'UTR clone of NM_004168
The sequence shown below is from the reference sequence of NM_004168. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CAGCCATTCGCTCCTACTGATGAGACAAGATGTGGTGATGACAGAATCAGCTTTTGTAATTATGTATAAT
AGCTCATGCATGTGTCCATGTCATAACTGTCTTCATACGCTTCTGCACTCTGGGGAAGAAGGAGTACATT
GAAGGGAGATTGGCACCTAGTGGCTGGGAGCTTGCCAGGAACCCAGTGGCCAGGGAGCGTGGCACTTACC
TTTGTCCCTTGCTTCATTCTTGTGAGATGATAAAACTGGGCACAGCTCTTAAATAAAATATAAATGAACA
AACTTTCTTTTATTTCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_004168.2
Summary 'This gene encodes a major catalytic subunit of succinate-ubiquinone oxidoreductase, a complex of the mitochondrial respiratory chain. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. Mutations in this gene have been associated with a form of mitochondrial respiratory chain deficiency known as Leigh Syndrome. A pseudogene has been identified on chromosome 3q29. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]'
Locus ID 6389

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.