GCNF (NR6A1) (NM_033334) Human 3' UTR Clone

CAT#: SC203877

3`UTR clone of nuclear receptor subfamily 6 group A member 1 (NR6A1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NR6A1
• Synonyms: CT150; GCNF; GCNF1; hGCNF; hRTR; NR61; RTR
• ACCN: NM_033334
• Insert Size: 284 bp
• Sequence Data:
  Insert Sequence

  >SC203877 3'UTR clone of NM_033334
  The sequence shown below is from the reference sequence of NM_033334. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATTCCTGCAAGACCAGTGTGGGCAAGGAATGACCTGTTCCAGGCGCCCTCCTCAGGCCAACCACAGCGT
  CTTGGGTGGGCAGGACAGGCTCTGGAGGGAAAAGCCAGAGAGACCAAGATGGAGGCTGTGGAGCAGCATT
  TCCCGTTGCCTCCATAGCAAGAAGAGTTTTTGTTTGTTTGTCTGTTTTTTTAACCTCATTTTTCTATATA
  TTTATTTCACGACAGAGTTGAATGTATGGCCTTCAACATGATGCACATGCTTTTGTGTGAATGCAGCCAA
  TGCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_033334.2
• Summary: 'This gene encodes an orphan nuclear receptor which is a member of the nuclear hormone receptor family. Its expression pattern suggests that it may be involved in neurogenesis and germ cell development. The protein can homodimerize and bind DNA, but in vivo targets have not been identified. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jun 2013]'
• Locus ID: 2649