TSTA3 (NM_003313) Human 3' UTR Clone

CAT#: SC203887

3`UTR clone of tissue specific transplantation antigen P35B (TSTA3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TSTA3
• Synonyms: FX; P35B; SDR4E1
• ACCN: NM_003313
• Insert Size: 322 bp
• Sequence Data:
  Insert Sequence

  >SC203887 3'UTR clone of NM_003313
  The sequence shown below is from the reference sequence of NM_003313. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCTGTGCTTGGTTCACTGACAACTACGAGCAGGCCCGGAAGTGAAGCTGGAAGACAGGATCAGGTGCCA
  GCGGACCATCGGCTGGCAGAGCCCAGCGGCCACCACCCGTCAACCCTGCCAGGAGCTGAGGGCACCACCC
  AGCAACCTGGGCCTGCATTCCATCCGCTCTGCAGCCCCAAGCATCTTTCCAGTGGGGCCCCCATTCACGT
  TGGTCCTCAGGGAAACCAGGGTCCCGGGCAGGCCCGGCGCTTTGCTCCCCACACCAGCCCCCTGCGCGTG
  TCCACTCTGATCCTGCATCCCACTCCCTGGGAGCCAATAAAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003313.3
• Summary: 'Tissue specific transplantation antigen P35B is a NADP(H)-binding protein. It catalyze the two-step epimerase and the reductase reactions in GDP-D-mannose metabolism, converting GDP-4-keto-6-D-deoxymannose to GDP-L-fucose. GDP-L-fucose is the substrate of several fucosyltransferases involved in the expression of many glycoconjugates, including blood group ABH antigens and developmental adhesion antigens. Mutations in this gene may cause leukocyte adhesion deficiency, type II. [provided by RefSeq, Jul 2008]'
• Locus ID: 7264