R Cadherin (CDH4) (NM_001794) Human 3' UTR Clone

CAT#: SC203898

3`UTR clone of cadherin 4 type 1 R-cadherin (retinal) (CDH4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CDH4
• Synonyms: CAD4; R-CAD; RCAD
• ACCN: NM_001794
• Insert Size: 296 bp
• Sequence Data:
  Insert Sequence

  >SC203898 3'UTR clone of NM_001794
  The sequence shown below is from the reference sequence of NM_001794. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTATGGAGGTGGTGAAGAGGATTGACTGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGC
  CGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGACTCCCTGCGGCTGTGTCCTTAGTGCTGTTA
  GGAGGCCCCCCAATCCCCACGTTGAGCTGTCTAGCATGAGCACCCACCCCCACAGCGCCCTGCACCCGGC
  CGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACTTGAATTTCCT
  AGAACAGAAGCACTGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001794.2
• Summary: 'This gene is a classical cadherin from the cadherin superfamily. The encoded protein is a calcium-dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Based on studies in chicken and mouse, this cadherin is thought to play an important role during brain segmentation and neuronal outgrowth. In addition, a role in kidney and muscle development is indicated. Of particular interest are studies showing stable cis-heterodimers of cadherins 2 and 4 in cotransfected cell lines. Previously thought to interact in an exclusively homophilic manner, this is the first evidence of cadherin heterodimerization. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]'
• Locus ID: 1002