GAMT (NM_000156) Human 3' UTR Clone

CAT#: SC203899

3`UTR clone of guanidinoacetate N-methyltransferase (GAMT) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GAMT
• Synonyms: CCDS2; HEL-S-20; PIG2; TP53I2
• ACCN: NM_000156
• Insert Size: 260 bp
• Sequence Data:
  Insert Sequence

  >SC203899 3'UTR clone of NM_000156
  The sequence shown below is from the reference sequence of NM_000156. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGGTGACCAAAGGCTGAGCCCCCACCCCGGCCCGGCCACACCCATGCCCTCCTCCGTGCCTTCCTGGCC
  GGGAGTCCAGGGTGTCGCACCAGCCCTGGGCTGATCCCAGCTGTGTGTCACCAGAAGCTTTCCCGGCTTC
  TCTGTGAGGGGTCCCACCAGCCCAGGGCTGATCCCAGCTGTGTGTCACCAGCAGCTTTCCCAGCTTCTCT
  GTGAGGGTCACTGCTGCCCACTGCAGGGTCCCTGAGGTGAAGTAAACGCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000156.4
• Summary: 'The protein encoded by this gene is a methyltransferase that converts guanidoacetate to creatine, using S-adenosylmethionine as the methyl donor. Defects in this gene have been implicated in neurologic syndromes and muscular hypotonia, probably due to creatine deficiency and accumulation of guanidinoacetate in the brain of affected individuals. Two transcript variants encoding different isoforms have been described for this gene. Pseudogenes of this gene are found on chromosomes 2 and 13. [provided by RefSeq, Feb 2012]'
• Locus ID: 2593