JMJD7 (NM_005090) Human 3' UTR Clone

CAT#: SC203928

3`UTR clone of JMJD7-PLA2G4B readthrough transcript (JMJD7-PLA2G4B) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: JMJD7
• Synonyms: cPLA2-beta; HsT16992
• ACCN: NM_005090
• Insert Size: 304
• Sequence Data:
  Insert Sequence

  >SC203928 3'UTR clone of NM_005090
  The sequence shown below is from the reference sequence of NM_005090. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGCGCCAGGCAGTGCAGCGGAGGCGGCAGCGCAGGCCCCACTGATGGCCGGGGCCCCTGCCACCCCTAA
  CTCTCATTCATTCCCTGGCTGCTGAGTTGCAGGTGGGAACTGTCATCACGCAGTGCTTCAGAGCCTCGGG
  CTCAGGTGGCACGGTCCCAGGGTCCAGGCTGAGGGCTGGGAGCTCCCTTGCGCCTCAGCAGTTTGCAGTG
  GGGTAAGGAGGCCAAGCCCATTTGTGTAATCACCCAAAACCCCCCGGCCTGTGCCTGTTTTCCCTTCTGC
  GCTACCTTGAGTAGTTGGAGCACT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_005090.3
• Summary: This locus represents naturally-occurring readthrough transcription between the neighboring jumonji domain containing 7 (JMJD7) and phospholipase A2, group IVB (cytosolic) (PLA2G4B) genes. Readthrough transcripts encode fusion proteins that share amino acid sequence with each individual gene product, including a partial JmjC domain and downstream C2 and phospholipase A2 domains. Alternatively spliced transcript variants have been observed. [provided by RefSeq, Oct 2013]
• Locus ID: 8681