SNRPC (NM_003093) Human 3' UTR Clone

CAT#: SC203937

3`UTR clone of small nuclear ribonucleoprotein polypeptide C (SNRPC) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SNRPC
• Synonyms: U1C; Yhc1
• ACCN: NM_003093
• Insert Size: 281 bp
• Sequence Data:
  Insert Sequence

  >SC203937 3'UTR clone of NM_003093
  The sequence shown below is from the reference sequence of NM_003093. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAATGACTCGACCAGACAGATAAGGATAGAGGGGAGGCCTTATTGTATCGGTTTTATATTACCTGTTCT
  GCTTCACCAGGAGATCATGCTGCTGTGATACTGAGTTTTCTAAACAGCATAAGGAAGACTTGCTCCCCTG
  TCCTATGAAAGAGAATAGTTTTGGAGGGGAGAAGTGGGACAAAAAAGATGCAGTTTTCCTTTGTATTGGG
  AAATGTGAAAATAAAATTGTCAACTCTTTCAGTTAAAAGTGTGTTCCCTTTTTCCTCCTCTCTGTGTTCT
  C
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003093.2
• Summary: 'This gene encodes one of the specific protein components of the U1 small nuclear ribonucleoprotein (snRNP) particle required for the formation of the spliceosome. The encoded protein participates in the processing of nuclear precursor messenger RNA splicing. snRNP particles are attacked by autoantibodies frequently produced by patients with connective tissue diseases. The genome contains several pseudogenes of this functional gene. Alternative splicing results in a non-coding transcript variant.[provided by RefSeq, Oct 2009]'
• Locus ID: 6631