MEK2 (MAP2K2) (NM_030662) Human 3' UTR Clone

CAT#: SC203958

3`UTR clone of mitogen-activated protein kinase kinase 2 (MAP2K2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MAP2K2
• Synonyms: CFC4; MAPKK2; MEK2; MKK2; PRKMK2
• ACCN: NM_030662
• Insert Size: 290 bp
• Sequence Data:
  Insert Sequence

  >SC203958 3'UTR clone of NM_030662
  The sequence shown below is from the reference sequence of NM_030662. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTGCGGCTGAACCAGCCCGGCACACCCACGCGCACCGCCGTGTGACAGTGGCCGGGCTCCCTGCGTCCC
  GCTGGTGACCTGCCCACCGTCCCTGTCCATGCCCCGCCCTTCCAGCTGAGGACAGGCTGGCGCCTCCACC
  CACCCTCCTGCCTCACCCCTGCGGAGAGCACCGTGGCGGGGCGACAGCGCATGCAGGAACGGGGGTCTCC
  TCTCCTGCCCGTCCTGGCCGGGGTGCCTCTGGGGACGGGCGACGCTGCTGTGTGTGGTCTCAGAGGCTCT
  GCTTCCTTAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_030662.3
• Summary: 'The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase is known to play a critical role in mitogen growth factor signal transduction. It phosphorylates and thus activates MAPK1/ERK2 and MAPK2/ERK3. The activation of this kinase itself is dependent on the Ser/Thr phosphorylation by MAP kinase kinase kinases. Mutations in this gene cause cardiofaciocutaneous syndrome (CFC syndrome), a disease characterized by heart defects, cognitive disability, and distinctive facial features similar to those found in Noonan syndrome. The inhibition or degradation of this kinase is also found to be involved in the pathogenesis of Yersinia and anthrax. A pseudogene, which is located on chromosome 7, has been identified for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 5605