Caspase 10 (CASP10) (NM_032974) Human 3' UTR Clone

CAT#: SC203977

3`UTR clone of caspase 10 apoptosis-related cysteine peptidase (CASP10) transcript variant B for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CASP10
• Synonyms: ALPS2; FLICE2; MCH4
• ACCN: NM_032974
• Insert Size: 315 bp
• Sequence Data:
  Insert Sequence

  >SC203977 3'UTR clone of NM_032974
  The sequence shown below is from the reference sequence of NM_032974. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGGTGGAGCAGCGTTTCCTAGTTCTTTCCAGAGGCTTCCTTCTGCCTGCCTTCCAGCCACATCGCCTGA
  GATTGACAACGCCCTACAGCAAGACGGAAACCTCCCTTTACAGCACCACCTTGCGATTCTGCAGCCACAA
  AGTTGAGACTTCTGAACGTGGCACTCTTCTGTTCCCTTACTGTTTCACGTGTACCTGTGTCATCTTTCTT
  GTTTCATCGTAAACATACTTCTAAAATTCCCATTTTCTTTATTTAGAAATAGAACTACAAGCGGATGGTT
  AAACAATTTAAACAAATGGTCCATGGGGAAAAGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_032974.3
• Summary: 'This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This protein cleaves and activates caspases 3 and 7, and the protein itself is processed by caspase 8. Mutations in this gene are associated with type IIA autoimmune lymphoproliferative syndrome, non-Hodgkin lymphoma and gastric cancer. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2011]'
• Locus ID: 843