XPB (ERCC3) (NM_000122) Human 3' UTR Clone

CAT#: SC204025

3`UTR clone of excision repair cross-complementing rodent repair deficiency complementation group 3 (xeroderma pigmentosum group B complementing) (ERCC3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ERCC3
• Synonyms: BTF2; GTF2H; RAD25; TFIIH; TTD2; XPB
• ACCN: NM_000122
• Insert Size: 350 bp
• Sequence Data:
  Insert Sequence

  >SC204025 3'UTR clone of NM_000122
  The sequence shown below is from the reference sequence of NM_000122. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAGCAAACATGTACACCCGCTCTTCAAGCGCTTTAGGAAATGATGCTTAGGCAGGGTACTTCGTTCAAG
  ACCGGCGCTTGGCACCCTTGTTGGAAAGGGATTTTCAGCATAACATTTTCCTTCCACCTCTTTGACCTTC
  CCTCCAGCGTTGGCCAAATTGTGCTGAGGAAGATGCATCAAGGGCTTGGCTGTGCCTTCATAGGTCATCT
  AGGGTTTTATAAAGGAGGAGGAGACAATATTTTTTCAAACTTTTTGGGGAGTGGGGTCATTTCTGTATAT
  AAAAAATGTTAATATTTAAGGTGTATTTATGTTACCGTTCTGAATAAACAGAATGGACCATTGAACCAGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000122.1
• Summary: 'This gene encodes an ATP-dependent DNA helicase that functions in nucleotide excision repair. The encoded protein is a subunit of basal transcription factor 2 (TFIIH) and, therefore, also functions in class II transcription. Mutations in this gene are associated with Xeroderma pigmentosum B, Cockayne's syndrome, and trichothiodystrophy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]'
• Locus ID: 2071