P2Y6 (P2RY6) (NM_176796) Human 3' UTR Clone

CAT#: SC204032

3`UTR clone of pyrimidinergic receptor P2Y G-protein coupled 6 (P2RY6) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "P2RY6"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol P2RY6
Synonyms P2Y6
ACCN NM_176796
Insert Size 306 bp
Sequence Data
>SC204032 3'UTR clone of NM_176796
The sequence shown below is from the reference sequence of NM_176796. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AACTCACAGCCAAATGGCAGAGGCAGGGTCGCTGAGTCCTCCAGGTCCTGGGCAGCCTTCATATTTGCCA
TTGTGTCCGGGGCACCAGGAGCCCCACCAACCCCAAACCATGCGGAGAATTAGAGTTCAGCTCAGCTGGG
CATGGAGTTAAGATCCCTCACAGGACCCAGAAGCTCACCAAAAACTATTTCTTCAGCCCCTTCTCTGGCC
CAGACCCTGTGGGCATGGAGATGGACAGACCTGGGCCTGGCTCTTGAGAGGTCCCAGTCAGCCATGGAGA
GCTGGGGAAACCACATTAAGGTGCTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_176796.1
Summary 'The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, which is a G-protein coupled receptor, is responsive to UDP, partially responsive to UTP and ADP, and not responsive to ATP. It is proposed that this receptor mediates inflammatory responses. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Mar 2013]'
Locus ID 5031

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.