Macrophage Inflammatory Protein 1 beta (CCL4) (NM_002984) Human 3' UTR Clone

CAT#: SC204039

3`UTR clone of chemokine (C-C motif) ligand 4 (CCL4) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CCL4
• Synonyms: ACT2; AT744.1; G-26; HC21; LAG-1; LAG1; MIP-1-beta; MIP1B; MIP1B1; SCYA2; SCYA4
• ACCN: NM_002984
• Insert Size: 311 bp
• Sequence Data:
  Insert Sequence

  >SC204039 3'UTR clone of NM_002984
  The sequence shown below is from the reference sequence of NM_002984. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGTGTATGACCTGGAACTGAACTGAGCTGCTCAGAGACAGGAAGTCTTCAGGGAAGGTCACCTGAGCCCG
  GATGCTTCTCCATGAGACACATCTCCTCCATACTCAGGACTCCTCTCCGCAGTTCCTGTCCCTTCTCTTA
  ATTTAATCTTTTTTATGTGCCGTGTTATTGTATTAGGTGTCATTTCCATTATTTATATTAGTTTAGCCAA
  AGGATAAGTGTCCCCTATGGGGATGGTCCACTGTCACTGTTTCTCTGCTGTTGCAAATACATGGATAACA
  CATTTGATTCTGTGTGTTTTCATAATAAAAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002984.2
• Summary: 'The protein encoded by this gene is a mitogen-inducible monokine and is one of the major HIV-suppressive factors produced by CD8+ T-cells. The encoded protein is secreted and has chemokinetic and inflammatory functions. [provided by RefSeq, Dec 2012]'
• Locus ID: 6351