VPS28 (NM_016208) Human 3' UTR Clone

CAT#: SC204047

3`UTR clone of vacuolar protein sorting 28 homolog (S. cerevisiae) (VPS28) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: VPS28
• Synonyms: MGC60323
• ACCN: NM_016208
• Insert Size: 229
• Sequence Data:
  Insert Sequence

  >SC204047 3'UTR clone of NM_016208
  The sequence shown below is from the reference sequence of NM_016208. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGTCAGCCTACAACGCCTTCAACCGCTTCCTGCATGCCTGAGCCCGGGGCACTAGCCCTTGCACAGAAGG
  GCAGAGTCTGAGGCGATGGCTCCTGGTCCCCTGTCCGCCACACAGGCCGTGGTCATCCACACAACTCACT
  GTCTGCAGCTGCCTGTCTGGTGTCTGTCTTTGGTGTCAGAACTTTGGGGGCCGGGCCCCTCCCCACAATA
  AAGATGCTCTCCGACCTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_016208.2
• Summary: This gene encodes a protein subunit of the ESCRT-I complex (endosomal complexes required for transport), which functions in the transport and sorting of proteins into subcellular vesicles. This complex can also be hijacked to facilitate the budding of enveloped viruses from the cell membrane. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
• Locus ID: 51160