COASY (NM_001042531) Human 3' UTR Clone

CAT#: SC204048

3`UTR clone of Coenzyme A synthase (COASY) nuclear gene encoding mitochondrial protein transcript variant 5 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "COASY"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol COASY
Synonyms DPCK; FLJ35179; NBP; pOV-2; PPAT; UKR1
ACCN NM_001042531
Insert Size 326
Sequence Data
>SC204048 3'UTR clone of NM_001042531
The sequence shown below is from the reference sequence of NM_001042531. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTCTTGCAGAAGCGCATTCCCAAGACTCATCAGGCCCTCGACTGAAAAGTTCTCAGTGGGGCCAGACTGG
CTCCTGGAGCTGACAAGCGACCCCGTGGTGAGGAGAAATGGGGGCCTTGATGCTCACCCTGGTTCAGGCC
CAGAGGTCCAAGCTATACTGTGCAGGACATGGCCAGGCCTGGTGGACACAGGAAGCCTACCCAACACGCT
GGTATTTGGCCAACACTGAGGATGTGGTTCATGGGGGAGCAGTCCCCTCCCCACTCTTGCCCATGGGTGA
CTCTTACCCACAGCTGACTAGGGCCAGCGCAAATACTGGAACCTGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001042531.1
Summary Coenzyme A (CoA) functions as a carrier of acetyl and acyl groups in cells and thus plays an important role in numerous synthetic and degradative metabolic pathways in all organisms. In eukaryotes, CoA and its derivatives are also involved in membrane trafficking and signal transduction. This gene encodes the bifunctional protein coenzyme A synthase (CoAsy) which carries out the last two steps in the biosynthesis of CoA from pantothenic acid (vitamin B5). The phosphopantetheine adenylyltransferase domain of this bifunctional protein catalyzes the conversion of 4'-phosphopantetheine into dephospho-coenzyme A (dpCoA) while its dephospho-CoA kinase domain completes the final step by phosphorylating dpCoA to form CoA. Mutations in this gene are associated with neurodegeneration with brain iron accumulation (NBIA). Alternative splicing results in multiple isoforms. [provided by RefSeq, Apr 2014]
Locus ID 80347

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.