Protein C (PROC) (NM_000312) Human 3' UTR Clone

CAT#: SC204063

3`UTR clone of protein C (inactivator of coagulation factors Va and VIIIa) (PROC) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PROC
• Synonyms: APC; PC; PROC1; THPH3; THPH4
• ACCN: NM_000312
• Insert Size: 342 bp
• Sequence Data:
  Insert Sequence

  >SC204063 3'UTR clone of NM_000312
  The sequence shown below is from the reference sequence of NM_000312. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATCAGAGACAAGGAAGCCCCCCAGAAGAGCTGGGCACCTTAGCGACCCTCCCTGCAGGGCTGGGCTTTT
  GCATGGCAATGGATGGGACATTAAAGGGACATGTAACAAGCACACCGGCCTGCTGTTCTGTCCTTCCATC
  CCTCTTTTGGGCTCTTCTGGAGGGAAGTAACATTTACTGAGCACCTGTTGTATGTCACATGCCTTATGAA
  TAGAATCTTAACTCCTAGAGCAACTCTGTGGGGTGGGGAGGAGCAGATCCAAGTTTTGCGGGGTCTAAAG
  CTGTGTGTGTTGAGGGGGATACTCTGTTTATGAAAAAGAATAAAAAACACAACCACGAAGCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000312.3
• Summary: 'This gene encodes a vitamin K-dependent plasma glycoprotein. The encoded protein is cleaved to its activated form by the thrombin-thrombomodulin complex. This activated form contains a serine protease domain and functions in degradation of the activated forms of coagulation factors V and VIII. Mutations in this gene have been associated with thrombophilia due to protein C deficiency, neonatal purpura fulminans, and recurrent venous thrombosis.[provided by RefSeq, Dec 2009]'
• Locus ID: 5624