Hepsin (HPN) (NM_182983) Human 3' UTR Clone

CAT#: SC204070

3`UTR clone of hepsin (HPN) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HPN
• Synonyms: TMPRSS1
• ACCN: NM_182983
• Insert Size: 301 bp
• Sequence Data:
  Insert Sequence

  >SC204070 3'UTR clone of NM_182983
  The sequence shown below is from the reference sequence of NM_182983. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGACTCACTCCGAAGCCAGCGGCATGGTGACCCAGCTCTGACCGGTGGCTTCTCGCTGCGCAGCCTCCAG
  GGCCCGAGGTGATCCCGGTGGTGGGATCCACGCTGGGCCTAGGATGGGACGTTTTTCTTCTTGGGCCCGG
  TCCACAGGTCCAAGGACACCCTCCCTCCAGGGTCCTCTCTTCCACAGTGGCGGGCCCACTCAGCCCCGAG
  ACCACCCAACCTCACCCTCCTGACCCCCATGTAAATATTGTTCTGCTGTCTGGGACTCCTGTCTAGGTGC
  CCCTGATGACGGGATGCTCTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_182983.2
• Summary: 'This gene encodes a type II transmembrane serine protease that may be involved in diverse cellular functions, including blood coagulation and the maintenance of cell morphology. Expression of the encoded protein is associated with the growth and progression of cancers, particularly prostate cancer. The protein is cleaved into a catalytic serine protease chain and a non-catalytic scavenger receptor cysteine-rich chain, which associate via a single disulfide bond. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]'
• Locus ID: 3249