NIF1 (ZNF335) (NM_022095) Human 3' UTR Clone

CAT#: SC204071

3`UTR clone of zinc finger protein 335 (ZNF335) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ZNF335
• Synonyms: MCPH10; NIF-1; NIF1; NIF2
• ACCN: NM_022095
• Insert Size: 336
• Sequence Data:
  Insert Sequence

  >SC204071 3'UTR clone of NM_022095
  The sequence shown below is from the reference sequence of NM_022095. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCATCGAGTACGACGTCATCACCCTGGCCGATGACTGAGCCCCGAGGGCCCAACACAGATCATGGATTTG
  CGGCCAGCTCTCCTGGGGGTAGGGGGCCACCAGGACTCACCTCCCTCTTCATTTAGGATCTCCAGATACT
  GGATAGCCAGCATCCTCTCATTCCCAGGGAGCCAGACCTGTGCTGTTGGGGTTAGGGGCAGCCATGGGCC
  CCAGCCAGGACATGCTGGGTGCCCCAGCCTGCAGGCAGGCTTTGGGAGAGAAATTTATTTTTGTTTGGGT
  GGACCCACTGGCCTGTCAGTCTCAATAAAGGGACCGGAGTCCAGTCCTGAACAGCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_022095.3
• Summary: The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
• Locus ID: 63925