BMP4 (NM_130851) Human 3' UTR Clone

CAT#: SC204082

3`UTR clone of bone morphogenetic protein 4 (BMP4) transcript variant 3 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "BMP4"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol BMP4
Synonyms BMP2B; BMP2B1; MCOPS6; OFC11; ZYME
ACCN NM_130851
Insert Size 330 bp
Sequence Data
>SC204082 3'UTR clone of NM_130851
The sequence shown below is from the reference sequence of NM_130851. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCAGGAGATGGTAGTAGAGGGATGTGGGTGCCGCTGAGATCAGGCAGTCCTTGAGGATAGACAGATATAC
ACACCACACACACACACCACATACACCACACACACACGTTCCCATCCACTCACCCACACACTACACAGAC
TGCTTCCTTATAGCTGGACTTTTATTTAAAAAAAAAAAAAAAAAAGGAAAAAATCCCTAAACATTCACCT
TGACCTTATTTATGACTTTACGTGCAAATGTTTTGACCATATTGATCATATATTTTGACAAAATATATTT
ATAACTACGTATTAAAAGAAAAAAATAAAATGAGTCATTATTTTAAAGGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_130851.2
Summary 'This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates heart development and adipogenesis. Mutations in this gene are associated with orofacial cleft and microphthalmia in human patients. The encoded protein may also be involved in the pathology of multiple cardiovascular diseases and human cancers. [provided by RefSeq, Jul 2016]'
Locus ID 652

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.