PANK4 (NM_018216) Human 3' UTR Clone

CAT#: SC204090

3`UTR clone of pantothenate kinase 4 (PANK4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PANK4
• Synonyms: DKFZp547M242; FLJ10782
• ACCN: NM_018216
• Insert Size: 334
• Sequence Data:
  Insert Sequence

  >SC204090 3'UTR clone of NM_018216
  The sequence shown below is from the reference sequence of NM_018216. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCGTCATCTTCAAGTACGAGGTCCCAGCCGAGTGAGGCGCTGCAGCTGCCGGACTCTTCTGCTTGTCACT
  TGTCAGGAATGTGTTTTTACCACCACAGGGAAACTGCGTTCAAATCAACGTATTTATATGGTACTGCTGT
  GACGCGGCACATACACCCCAGCCGCACAGATGCGTGTGACCCAGAGGCGAGACGCAGCTTTGTCCTGGGA
  GACGTTCATATTGGAATCTATTTAACTGCTAAAGAACCTTTTATATATATATATATATAAATAGAGAGAT
  CTATACAGGTATGTCTGACGGGACGCAGCACCGTGGGCACGCACCAAATAGAGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_018216.1
• Summary: This gene encodes a protein belonging to the pantothenate kinase family. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by CoA. This family member is most abundant in muscle but is expressed in all tissues. [provided by RefSeq, Jul 2008]
• Locus ID: 55229