Leukotriene B4 Receptor 2 (LTB4R2) (NM_001164692) Human 3' UTR Clone

CAT#: SC204092

3`UTR clone of leukotriene B4 receptor 2 (LTB4R2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LTB4R2
• Synonyms: BLT2; BLTR2; JULF2; KPG_004; LTB4-R 2; LTB4-R2; NOP9
• ACCN: NM_001164692
• Insert Size: 336
• Sequence Data:
  Insert Sequence

  >SC204092 3'UTR clone of NM_001164692
  The sequence shown below is from the reference sequence of NM_001164692. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGATGGAGAAGGACGGTCCGGAATGGGACCTTTGACAGCAGACCCTACAACCTGCTGCCCTTCCCTGTCC
  CTTTCCACCCCCCACCCACCCTCCAGAGGTCAGTGTTCTGGGACATTTGGGGACCCTTCTTTGACTAGAG
  TTTGGATCTGGCTGGGTAGGATTACTATACACTTGGGGCAGGCCCAGGCTCCTCCAAACTGAGGGATTAT
  GAGGGTGGTGATGGTCCCTGTTAAGGACTATTGTGTGCTTGCAAGTTGGCATGTACCCATGTGCCAGCAT
  TGCTTACTTGTTGCCAATAGCTGTTATTGTGAAATACACTGGGAAGCCATTAGATG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001164692.2
• Summary: Low-affinity receptor for leukotrienes including leukotriene B4. Mediates chemotaxis of granulocytes and macrophages. The response is mediated via G-proteins that activate a phosphatidylinositol-calcium second messenger system. The rank order of affinities for the leukotrienes is LTB4 > 12-epi-LTB4 > LTB5 > LTB3. [UniProtKB/Swiss-Prot Function]
• Locus ID: 56413