IL32 (NM_001012635) Human 3' UTR Clone

CAT#: SC204102

3`UTR clone of interleukin 32 (IL32) transcript variant 6 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "IL32"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol IL32
Synonyms IL-32alpha; IL-32beta; IL-32delta; IL-32gamma; NK4; TAIF; TAIFa; TAIFb; TAIFc; TAIFd
ACCN NM_001012635
Insert Size 322 bp
Sequence Data
>SC204102 3'UTR clone of NM_001012635
The sequence shown below is from the reference sequence of NM_001012635. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGAAGTGCTCTGAACCCCAATCCTCAAAATGAAGATACTGACACCACCTTTGCCCTCCCCGTCACCGCGC
ACCCACCCTGACCCCTCCCTCAGCTGTCCTGTGCCCCGCCCTCTCCCGCACACTCAGTCCCCCTGCCTGG
CGTTCCTGCCGCAGCTCTGACCTGGTGCTGTCGCCCTGGCATCTTAATAAAACCTGCTTATACTTCCCTG
GCAGGGGAGATACCATGATCGCGGAGGTGGGTTTCCCAGGGCAAGGCTGATCTGTTGCCGTATTAGTCCG
TTTTCACACAGCTATAAAGAATGCCTGAGACTGGGTGATGTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001012635.1
Summary This gene encodes a member of the cytokine family. The protein contains a tyrosine sulfation site, 3 potential N-myristoylation sites, multiple putative phosphorylation sites, and an RGD cell-attachment sequence. Expression of this protein is increased after the activation of T-cells by mitogens or the activation of NK cells by IL-2. This protein induces the production of TNFalpha from macrophage cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Locus ID 9235

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.