IL32 (NM_004221) Human 3' UTR Clone

CAT#: SC204104

3`UTR clone of interleukin 32 (IL32) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IL32
• Synonyms: IL-32alpha; IL-32beta; IL-32delta; IL-32gamma; NK4; TAIF; TAIFa; TAIFb; TAIFc; TAIFd
• ACCN: NM_004221
• Insert Size: 322
• Sequence Data:
  Insert Sequence

  >SC204104 3'UTR clone of NM_004221
  The sequence shown below is from the reference sequence of NM_004221. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAAGTGCTCTGAACCCCAATCCTCAAAATGAAGATACTGACACCACCTTTGCCCTCCCCGTCACCGCGC
  ACCCACCCTGACCCCTCCCTCAGCTGTCCTGTGCCCCGCCCTCTCCCGCACACTCAGTCCCCCTGCCTGG
  CGTTCCTGCCGCAGCTCTGACCTGGTGCTGTCGCCCTGGCATCTTAATAAAACCTGCTTATACTTCCCTG
  GCAGGGGAGATACCATGATCGCGGAGGTGGGTTTCCCAGGGCAAGGCTGATCTGTTGCCGTATTAGTCCG
  TTTTCACACAGCTATAAAGAATGCCTGAGACTGGGTGATGTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004221.4
• Summary: This gene encodes a member of the cytokine family. The protein contains a tyrosine sulfation site, 3 potential N-myristoylation sites, multiple putative phosphorylation sites, and an RGD cell-attachment sequence. Expression of this protein is increased after the activation of T-cells by mitogens or the activation of NK cells by IL-2. This protein induces the production of TNFalpha from macrophage cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
• Locus ID: 9235