BLBP (FABP7) (NM_001446) Human 3' UTR Clone

CAT#: SC204109

3`UTR clone of fatty acid binding protein 7 brain (FABP7) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FABP7
• Synonyms: B-FABP; BLBP; FABPB; MRG
• ACCN: NM_001446
• Insert Size: 318 bp
• Sequence Data:
  Insert Sequence

  >SC204109 3'UTR clone of NM_001446
  The sequence shown below is from the reference sequence of NM_001446. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTGATGTGGTTGCTGTTCGCCACTATGAGAAGGCATAAAAATGTTCCTGGTCGGGGCTTGGAAGAGCTCT
  TCAGTTTTTCTGTTTCCTCAAGTCTCAGTGCTATCCTATTACAACATGGCTGATCATTAATTAGAAGGTT
  ATCCTTGGTGTGGAGGTGGAAAATGGTGATTTAAAAACTTGTTACTCCAAGCAACTTGCCCAATTTTAAT
  CTGAAAATTTATCATGTTTTATAATTTGAATTAAAGTTTTGTCCCCCCCCCCCTTTTTTTTATAAACAAG
  TGAATACATTTTATAATTTCTTTTGGAATGTAAATCAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001446.3
• Summary: 'The gene encodes a small, highly conserved cytoplasmic protein that bind long-chain fatty acids and other hydrophobic ligands. The encoded protein is important in the establishment of the radial glial fiber in the developing brain. Alternative splicing and promoter usage results in multiple transcript variants encoding different isoforms. Pseudogenes of this gene are found on multiple chromosomes. [provided by RefSeq, Jan 2016]'
• Locus ID: 2173