PLCG 2 (PLCG2) (NM_002661) Human 3' UTR Clone

CAT#: SC204122

3`UTR clone of phospholipase C gamma 2 (phosphatidylinositol-specific) (PLCG2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PLCG2
• Synonyms: APLAID; FCAS3; PLC-gamma-2; PLC-IV
• ACCN: NM_002661
• Insert Size: 301 bp
• Sequence Data:
  Insert Sequence

  >SC204122 3'UTR clone of NM_002661
  The sequence shown below is from the reference sequence of NM_002661. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAAGAGAGTCAGCAACAGCAAGTTTTACTCATAGAAGCTGGGGTATGTGTGTAAGGGTATTGTGTGTGTG
  CGCATGTGTGTTTGCATGTAGGAGAACGTGCCCTATTCACACTCTGGGAAGACGCTAATCTGTGACATCT
  TTTCTTCAAGCCTGCCATCAAGGACATTTCTTAAGACCCAACTGGCATGAGTTGGGGTAATTTCCTATTA
  TTTTCATCTTGGACAACTTTCTTAACTTATATTCTTTATAGAGGATTCCCCAAAATGTGCTCCTCATTTT
  TGGCCTCTCATGTTCCAAACC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002661.2
• Summary: 'The protein encoded by this gene is a transmembrane signaling enzyme that catalyzes the conversion of 1-phosphatidyl-1D-myo-inositol 4,5-bisphosphate to 1D-myo-inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) using calcium as a cofactor. IP3 and DAG are second messenger molecules important for transmitting signals from growth factor receptors and immune system receptors across the cell membrane. Mutations in this gene have been found in autoinflammation, antibody deficiency, and immune dysregulation syndrome and familial cold autoinflammatory syndrome 3. [provided by RefSeq, Mar 2014]'
• Locus ID: 5336