GM CSF (CSF2) (NM_000758) Human 3' UTR Clone

CAT#: SC204127

3`UTR clone of colony stimulating factor 2 (granulocyte-macrophage) (CSF2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CSF2
• Synonyms: CSF; GMCSF
• ACCN: NM_000758
• Insert Size: 309 bp
• Sequence Data:
  Insert Sequence

  >SC204127 3'UTR clone of NM_000758
  The sequence shown below is from the reference sequence of NM_000758. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGCCAGTCCAGGAGTGAGACCGGCCAGATGAGGCTGGCCAAGCCGGGGAGCTGCTCTCTCATGAAACAA
  GAGCTAGAAACTCAGGATGGTCATCTTGGAGGGACCAAGGGGTGGGCCACAGCCATGGTGGGAGTGGCCT
  GGACCTGCCCTGGGCCACACTGACCCTGATACAGGCATGGCAGAAGAATGGGAATATTTTATACTGACAG
  AAATCAGTAATATTTATATATTTATATTTTTAAAATATTTATTTATTTATTTATTTAAGTTCATATTCCA
  TATTTATTCAAGATGTTTTACCGTAATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000758.2
• Summary: 'The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of granulocytes and macrophages. The active form of the protein is found extracellularly as a homodimer. This gene has been localized to a cluster of related genes at chromosome region 5q31, which is known to be associated with interstitial deletions in the 5q- syndrome and acute myelogenous leukemia. Other genes in the cluster include those encoding interleukins 4, 5, and 13. This gene plays a role in promoting tissue inflammation. Elevated levels of cytokines, including the one produced by this gene, have been detected in SARS-CoV-2 infected patients that develop acute respiratory distress syndrome. Mice deficient in this gene or its receptor develop pulmonary alveolar proteinosis. [provided by RefSeq, Aug 2020]'
• Locus ID: 1437