PGK2 (NM_138733) Human 3' UTR Clone

CAT#: SC204137

3`UTR clone of phosphoglycerate kinase 2 (PGK2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PGK2
• Synonyms: dJ417L20.2; HEL-S-272; PGKB; PGKPS
• ACCN: NM_138733
• Insert Size: 317 bp
• Sequence Data:
  Insert Sequence

  >SC204137 3'UTR clone of NM_138733
  The sequence shown below is from the reference sequence of NM_138733. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATCCTTCCTGGAGTAGAGGCCCTCAGCAACATGTAGTTAATATAGTGTTACTTCCTTCTGTTTTCTGTCC
  ATGGCCCTTAAGTCAGCTTAATGCTTTTACATCTCGATGTGACTTTTGTTAAAATCTACTCCTAGATCAA
  GACCTATGTAATGGACAAGCAGCAGGCCATCAGGAACTCTTAATATCAGCACAGCAATTCATTTTAGTTT
  GGTCACGCATTTGCCTGTTCAAGTTCTCATTTGAACTTCACCATTGTGCTATCTAGGGAGGACATATTCT
  TAAGTTGCCTATTAAAGAAAGTGAGCTGAAGAAACTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_138733.3
• Summary: 'This gene is intronless, arose via retrotransposition of the phosphoglycerate kinase 1 gene, and is expressed specifically in the testis. Initially assumed to be a pseudogene, the encoded protein is actually a functional phosphoglycerate kinase that catalyzes the reversible conversion of 1,3-bisphosphoglycerate to 3-phosphoglycerate, during the Embden-Meyerhof-Parnas pathway of glycolysis, in the later stages of spermatogenesis.[provided by RefSeq, May 2010]'
• Locus ID: 5232