FBXO16 (NM_172366) Human 3' UTR Clone

CAT#: SC204139

3`UTR clone of F-box protein 16 (FBXO16) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FBXO16
• Synonyms: FBX16
• ACCN: NM_172366
• Insert Size: 325
• Sequence Data:
  Insert Sequence

  >SC204139 3'UTR clone of NM_172366
  The sequence shown below is from the reference sequence of NM_172366. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAGAAATCCCTTCCCACTATGTCCCTAAGTGCCAGCTCTCCCCTAAAAGTTCCAGCTCATCTCGCCTGG
  CCTCCCCCTGAGTCAGTGGGACTCCCAGACACTGCCACCACAGCTGAAATTCTCATGCAGCATCCTCACA
  GGCACCCTGGGCCCCAAGCATGACTCATCCAGGTTCCAGAGCCAAAGTGGACTGAACATGGAAAGACTTT
  TATTATAGAAATGACAAGATGCTTTGCACAGTGGAGAGCTGAATTTACTTGGCTCCCATTAGAAACTCTT
  TCAGCTTAAGTACTTATTGTGGTAGTGAGTCCTACGGTATTTCAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_172366.2
• Summary: This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
• Locus ID: 157574