KCNK4 (NM_033310) Human 3' UTR Clone

CAT#: SC204142

3`UTR clone of potassium channel subfamily K member 4 (KCNK4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: KCNK4
• Synonyms: FHEIG; K2p4.1; TRAAK; TRAAK1
• ACCN: NM_033310
• Insert Size: 309
• Sequence Data:
  Insert Sequence

  >SC204142 3'UTR clone of NM_033310
  The sequence shown below is from the reference sequence of NM_033310. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCCGAGACAAAGGCGTGCCGGTGTAGGGGCAGGATCCCTGGCCGGGCCTCTCAAGGGCTTCGTTTCTGCT
  CTCCCCGGCATGCCTGGCTTGTTTGACCAAAGAGCCCTCTTTCCACGAGACTGAAGTCTGGGGAGGAGGC
  TACAGTTGCCTCTCCGCCTCCTCCCTGGCCCCGGCCCTTCCCTCACTTCCATCCATCTCTAGACCCCCCC
  AAGGCTTTCTGTGTCGCTGCCCCGGGCGGGTGTATCCCTCACAGCACCTCACGACTGTGCCTCAAAGCCT
  GCATCAATAAATGAAAACGGTCTGCACCG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_033310.2
• Summary: This gene encodes a member of the TWIK-related arachidonic acid-stimulated two pore potassium channel subfamily. The encoded protein homodimerizes and functions as an outwardly rectifying channel. This channel is regulated by polyunsaturated fatty acids, temperature and mechanical deformation of the lipid membrane. This protein is expressed primarily in neural tissues and may be involved in regulating the noxious input threshold in dorsal root ganglia neurons. Alternate splicing results in multiple transcript variants. Naturally occurring read-through transcripts also exist between this gene and the downstream testis expressed 40 (TEX40) gene, as represented in GeneID: 106780802. [provided by RefSeq, Nov 2015]
• Locus ID: 50801