PSMD14 (NM_005805) Human 3' UTR Clone

CAT#: SC204143

3`UTR clone of proteasome (prosome macropain) 26S subunit non-ATPase 14 (PSMD14) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PSMD14
• Synonyms: PAD1; POH1; RPN11
• ACCN: NM_005805
• Insert Size: 358
• Sequence Data:
  Insert Sequence

  >SC204143 3'UTR clone of NM_005805
  The sequence shown below is from the reference sequence of NM_005805. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTGTCCAGTGTTTAGCAGCTATGTTGGATACTGTCGTATTTAAATAAAGCAACGAAAAACGCTATTAATG
  ATGCCTTCAGTGTATATTCCTCTGTTGTTCCTAATGCTCAAAATCAAGGGACCTCTGAAGGTGTACTTGG
  CTAAATGTAAGACATCTGGCATCATTTGCAGCACTGTAACACCTTCAGTCTCAGTTGTGCAATTACTTCT
  GTTTCTTTAGTCAGGGTCTTTGCAGATTCTAAAGTTATACATGAATACATCAAAGTGGACAAATTTTGTT
  AAGATCCCATTTAATATTTGAAAAAATCAGTAGCACAAATATATTTTGATTGTCACTTACAAAATAAAAT
  ACATTTAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_005805.4
• Summary: This gene encodes a component of the 26S proteasome. The 26S proteasome is a large multiprotein complex that catalyzes the degradation of ubiquitinated intracellular proteins. The encoded protein is a component of the 19S regulatory cap complex of the 26S proteasome and mediates substrate deubiquitination. A pseudogene of this gene is also located on the long arm of chromosome 2. [provided by RefSeq, Feb 2012]
• Locus ID: 10213