FXYD2 (NM_001680) Human 3' UTR Clone

CAT#: SC204168

3`UTR clone of FXYD domain containing ion transport regulator 2 (FXYD2) transcript variant a for miRNA target validation

Reconstitution Protocol

USD 560.00

5 Days*

Size
    • 10 ug

Product Images

Other products for "FXYD2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol FXYD2
Synonyms ATP1G1; HOMG2
ACCN NM_001680
Insert Size 334 bp
Sequence Data
>SC204168 3'UTR clone of NM_001680
The sequence shown below is from the reference sequence of NM_001680. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGGCAATAAGAAGCGCAGGCAAATCAATGAAGATGAGCCGTAACAGCAGCCTCGGCGGTGCCACCCACTG
CACTGGGGCCAGCTGGGAAGCCAAGCATGGCCCTGCCTCTGGCGCCTCCCCTTCTTCCCTGGGCTTTAGA
CCTTTGTCCCCGTCACTGCCAGCGCTTGGGCTGAAGGAAGCTCCAGACTCAATGTGACCCCCAGGTGGCA
TCGCCAACTCCTGCCTCGTGCCACCTCATGCTTATAATAAAGCCGGCGTCAGAGACCGCTGCTTCCCTCA
CCTGCCTGCCTGTCTCCCTCCTCTGTCACCACCAGCCTCTCCAAGCTCAAGTAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001680.4
Summary 'This gene encodes a member of the FXYD family of transmembrane proteins. This particular protein encodes the sodium/potassium-transporting ATPase subunit gamma. Mutations in this gene have been associated with Renal Hypomagnesemia-2. Alternatively spliced transcript variants have been described. Read-through transcripts have been observed between this locus and the upstream FXYD domain-containing ion transport regulator 6 (FXYD6, GeneID 53826) locus.[provided by RefSeq, Feb 2011]'
Locus ID 486

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.