RPL41 (NM_021104) Human 3' UTR Clone

CAT#: SC204174

3`UTR clone of ribosomal protein L41 (RPL41) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RPL41
• Synonyms: L41
• ACCN: NM_021104
• Insert Size: 317 bp
• Sequence Data:
  Insert Sequence

  >SC204174 3'UTR clone of NM_021104
  The sequence shown below is from the reference sequence of NM_021104. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AAGATGAGGCAGAGGTCCAAGTAAACCGCTAGCTTGTTGCACCGTGGAGGCCACAGGAGCAGAAACATGG
  AATGCCAGACGCTGGGGATGCTGGTACAAGTTGTGGGACTGCATGCTACTGTCTAGAGCTTGTCTCAATG
  GATCTAGAACTTCATCGCCCTCTGATCGCCGATCACCTCTGAGACCCACCTTGCTCATAAACAAAATGCC
  CATGTTGGTCCTCTGCCCTGGACCTGTGACATTCTGGACTATTTCTGTGTTTATTTGTGGCCGAGTGTAA
  CAACCATATAATAAATCACCTCTTCCGCTGTTTTAGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_021104.1
• Summary: 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which shares sequence similarity with the yeast ribosomal protein YL41, belongs to the L41E family of ribosomal proteins. It is located in the cytoplasm. The protein can interact with the beta subunit of protein kinase CKII and can stimulate the phosphorylation of DNA topoisomerase II-alpha by CKII. Two alternative splice variants have been identified, both encoding the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]'
• Locus ID: 6171