beta III Tubulin (TUBB3) (NM_006086) Human 3' UTR Clone

CAT#: SC204188

3`UTR clone of tubulin beta 3 (TUBB3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TUBB3
• Synonyms: beta-4; CDCBM; CDCBM1; CFEOM3; CFEOM3A; FEOM3; TUBB4
• ACCN: NM_006086
• Insert Size: 337
• Sequence Data:
  Insert Sequence

  >SC204188 3'UTR clone of NM_006086
  The sequence shown below is from the reference sequence of NM_006086. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TACGAAGACGACGAGGAGGAGTCGGAGGCCCAGGGCCCCAAGTGAAGCTGCTCGCAGCTGGAGTGAGAGG
  CAGGTGGCGGCCGGGGCCGAAGCCAGCAGTGTCTAAACCCCCGGAGCCATCTTGCTGCCGACACCCTGCT
  TTCCCCTCGCCCTAGGGCTCCCTTGCCGCCCTCCTGCAGTATTTATGGCCTCGTCCTCCCCACCTAGGCC
  ACGTGTGAGCTGCTCCTGTCTCTGTCTTATTGCAGCTCCAGGCCTGACGTTTTACGGTTTTGTTTTTTAC
  TGGTTTGTGTTTATATTTTCGGGGATACTTAATAAATCTATTGCTGTCAGATACCCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006086.2
• Summary: This gene encodes a class III member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is primarily expressed in neurons and may be involved in neurogenesis and axon guidance and maintenance. Mutations in this gene are the cause of congenital fibrosis of the extraocular muscles type 3. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Oct 2010]
• Locus ID: 10381