NOLA1 (GAR1) (NM_032993) Human 3' UTR Clone

CAT#: SC204192

3`UTR clone of GAR1 ribonucleoprotein homolog (yeast) (GAR1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GAR1
• Synonyms: NOLA1
• ACCN: NM_032993
• Insert Size: 308
• Sequence Data:
  Insert Sequence

  >SC204192 3'UTR clone of NM_032993
  The sequence shown below is from the reference sequence of NM_032993. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGTGGTTTCAGAGGGAGAGGACATTAAGTGAAACAGTTGACAGACATCACCAGTTGACTTCTGCATTAA
  CCTGCATGATCTGTTTCTACTATGGATTGGAAACTTGTTTCTTGAACAAGTCTTGAAGATCTTGGTCATT
  TTATGACAATGGATCTAAAATGTCAGCATCATGCAAAGTGCAACGGAATAGTGAATTTTGCTCTAAAAGA
  GCATGAACAAGTCTTTCTAATGTTTTGTACAGTGCCTGGCACTCTGTGGGTGCTCAATAAATGGATAGGA
  GTTTTCATTTGAAGCATATTTGAATTTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_032993.2
• Summary: This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA2 and NOLA3 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. These four H/ACA snoRNP proteins are also components of the telomerase complex. The encoded protein of this gene contains two glycine- and arginine-rich domains and is related to Saccharomyces cerevisiae Gar1p. Two splice variants have been found for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 54433