GGT5 (NM_001099781) Human 3' UTR Clone

CAT#: SC204210

3`UTR clone of gamma-glutamyltransferase 5 (GGT5) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GGT5"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GGT5
Synonyms GGL; GGT-REL; GGT 5; GGTLA1
ACCN NM_001099781
Insert Size 353 bp
Sequence Data
>SC204210 3'UTR clone of NM_001099781
The sequence shown below is from the reference sequence of NM_001099781. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TCTCGGACCTGAGGAAGAGTGGGGAGGCCGCAGGCTACTAAGACACTGCTCTGCCCAGAGCTGAAGTCTG
GCCCCACCATGAGTCCTGTGTCCAGGCCGGACATGGCTGGGGGACCAACTACTCTGGCAGGATCTGGACC
CCTGGCAGGGGAGTCCAGCTGAGAGTGGAAGAGGTGGCGGGGACCAGCTGGGCAGATGAGAGGCTGAGCC
TCATCCCTAACCCCCTTTCCCAGAGCCCCTGGTGGTCCTGAACCGGCCCCTCTATCCCTCCGCAGGCCTC
TTGCCTGGGGCCACTCTCCCACCCTCTCGATCTGTATATCCTCCAGTCCAAGATTAAAGAGGCGGACTGT
GGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001099781.1
Summary 'This gene is a member of the gamma-glutamyl transpeptidase gene family, and some reports indicate that it is capable of cleaving the gamma-glutamyl moiety of glutathione. The protein encoded by this gene is synthesized as a single, catalytically-inactive polypeptide, that is processed post-transcriptionally to form a heavy and light subunit, with the catalytic activity contained within the small subunit. The encoded enzyme is able to convert leukotriene C4 to leukotriene D4, but appears to have distinct substrate specificity compared to gamma-glutamyl transpeptidase. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]'
Locus ID 2687

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.