AP3B2 (NM_004644) Human 3' UTR Clone

CAT#: SC204235

3`UTR clone of adaptor-related protein complex 3 beta 2 subunit (AP3B2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AP3B2
• Synonyms: EIEE48; NAPTB
• ACCN: NM_004644
• Insert Size: 298
• Sequence Data:
  Insert Sequence

  >SC204235 3'UTR clone of NM_004644
  The sequence shown below is from the reference sequence of NM_004644. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGATACAGGCTCTGACCCAGTGACTTCCAAATGCTGTGACCTGTTTGGCTCCCATCTATACCTCCCCATG
  ACACCTAGGCTGTCAGTCTCTCTCATCTTTCTCTCTCTCTCTCATCATCCTCCTCATGCCAGATAGCATT
  CAGGGTGTCCTCTCTCCCTCTGGAGGACCAAGCCCTCCCCTAATGCCCTCCCCATGGATTCCTTAGTGAT
  CTGTGCAGAGAGAGATGGCAGCCACTCCCTTCAGTCCTCCCAGATTTCTGTAGCTATTTATGTAGCAGGC
  TCAATAAAATGTCTTCTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_004644.3
• Summary: Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
• Locus ID: 8120