ADSSL1 (NM_152328) Human 3' UTR Clone

CAT#: SC204240

3`UTR clone of adenylosuccinate synthase like 1 (ADSSL1) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ADSSL1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ADSSL1
Synonyms Adss1; MPD5
ACCN NM_152328
Insert Size 310
Sequence Data
>SC204240 3'UTR clone of NM_152328
The sequence shown below is from the reference sequence of NM_152328. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAGAGTCGATGATCCAGCTGTTTTAGTCACAGACTGAGCTGATCCCAACAGGCCCTGGCAGCGTCTGGAC
TTGTGTAAACAGCAGCAGTCACGTTCCTCGGCCGCCACAACCAACACCAAAGCAGGAAAACCATTTTCTG
TACTTTTATATTTCTGTTCAACCTGTTGGTTTCTACAATGATTTTAAACATTGGAAAGCCAGCCTTGTGT
ATATTTTTAAAAATTATATTCAAAATGAGCCAAAGTGCTCAGAGACCTTCTATGACACATTAGTGTCACA
TGGTTGCGTGTCCAGCCGAAGCAGTGTAAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_152328.3
Summary This gene encodes a member of the adenylosuccinate synthase family of proteins. The encoded muscle-specific enzyme plays a role in the purine nucleotide cycle by catalyzing the first step in the conversion of inosine monophosphate (IMP) to adenosine monophosphate (AMP). Mutations in this gene may cause adolescent onset distal myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Locus ID 122622

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.