CLECSF6 (CLEC4A) (NM_194448) Human 3' UTR Clone

CAT#: SC204274

3`UTR clone of C-type lectin domain family 4 member A (CLEC4A) transcript variant 4 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CLEC4A
• Synonyms: CD367; CLECSF6; DCIR; DDB27; HDCGC13P; LLIR
• ACCN: NM_194448
• Insert Size: 354
• Sequence Data:
  Insert Sequence

  >SC204274 3'UTR clone of NM_194448
  The sequence shown below is from the reference sequence of NM_194448. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAAGGTCAGTTTGTGAGATGATGAAGATCCACTTATGAACTGAACATTCTCCATGAACAGGTGGTTGGA
  TTGGTATCTGTCATTGTAGGGATAGATAATAAGCTCTTCTTATTCATGTGTAAGGGAGGTCCATAGAATT
  TAGGTGGTCTGTCAACTATTCTACTTATGAGAGAATTGGTCTGTACATTGACTGATTCACTTTTTCATAA
  AGTGAGCATTTATTGAGCATTTTTTCATGTGCCAGAGCCTGTACTGGAGGCCCCCATTGTGCACACATGG
  AGAGAACATGAGTCTCTCTTAATTTTTATCTGGTTGCTAAAGAATTATTTACCAATAAAATTATATGATG
  TGGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_194448.2
• Summary: This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in inflammatory and immune response. Multiple transcript variants encoding distinct isoforms have been identified for this gene. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. [provided by RefSeq, Jul 2008]
• Locus ID: 50856