STUB1 (NM_005861) Human 3' UTR Clone

CAT#: SC204286

3`UTR clone of STIP1 homology and U-box containing protein 1 (STUB1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: STUB1
• Synonyms: CHIP; HSPABP2; NY-CO-7; SCA48; SCAR16; SDCCAG7; UBOX1
• ACCN: NM_005861
• Insert Size: 293
• Sequence Data:
  Insert Sequence

  >SC204286 3'UTR clone of NM_005861
  The sequence shown below is from the reference sequence of NM_005861. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CATCTCTGAGAATGGCTGGGTGGAGGACTACTGAGGTTCCCTGCCCTACCTGGCGTCCTGGTCCAGGGGA
  GCCCTGGGCAGAAGCCCCCGGCCCCTATACATAGTTTATGTTCCTGGCCACCCCGACCGCTTCCCCCAAG
  TTCTGCTGTTGGACTCTGGACTGTTTCCCCTCTCAGCATCGCTTTTGCTGGGCCGTGATCGTCCCCCTTT
  GTGGGCTGGAAAAGCAGGTGAGGGTGGGCTGGGCTGAGGCCATTGCCGCCACTATCTGTGTAATAAAATC
  CGTGAGCACGAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_005861.2
• Summary: This gene encodes a protein containing tetratricopeptide repeat and a U-box that functions as a ubiquitin ligase/cochaperone. The encoded protein binds to and ubiquitinates shock cognate 71 kDa protein (Hspa8) and DNA polymerase beta (Polb), among other targets. Mutations in this gene cause spinocerebellar ataxia, autosomal recessive 16. Alternative splicing results in multiple transcript variants. There is a pseudogene for this gene on chromosome 2. [provided by RefSeq, Jun 2014]
• Locus ID: 10273