POLE4 (NM_019896) Human 3' UTR Clone

CAT#: SC204292

3`UTR clone of polymerase (DNA-directed) epsilon 4 (p12 subunit) (POLE4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: POLE4
• Synonyms: p12; YHHQ1
• ACCN: NM_019896
• Insert Size: 333
• Sequence Data:
  Insert Sequence

  >SC204292 3'UTR clone of NM_019896
  The sequence shown below is from the reference sequence of NM_019896. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGAAGCTGTGGATGAATTTGCTTTTCTGGAAGGTACTTTAGATTGATTGCCGAGCGGGGCAGTTTTGTGA
  GCCTTCATCTGAAGCCTTCAGTTCACCCCTCTGCACAGGCCTCAGCTTTGAAGAACGGAGTCTTTGCACT
  TACACACACTCTTCCTGTTCTGCCTTCACCTATGCCGGGATAAGCAGAGATCTCATCAATTAGCTCTTCT
  CTGCAAGGTCTTCCACTATTTCTGTCTGTCTTCCATATCAAGCCTGGATGCAGCTGCTGCTGCTTAGAGC
  AGAGATGAAGAAAGTGTTCTGCATAAGTGGCTTCCTGAATGATGAGGACCAGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_019896.2
• Summary: POLE4 is a histone-fold protein that interacts with other histone-fold proteins to bind DNA in a sequence-independent manner. These histone-fold protein dimers combine within larger enzymatic complexes for DNA transcription, replication, and packaging. [supplied by OMIM, Apr 2004]
• Locus ID: 56655