PIGU (NM_080476) Human 3' UTR Clone

CAT#: SC204303

3`UTR clone of phosphatidylinositol glycan anchor biosynthesis class U (PIGU) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PIGU
• Synonyms: CDC91L1; GAB1
• ACCN: NM_080476
• Insert Size: 310
• Sequence Data:
  Insert Sequence

  >SC204303 3'UTR clone of NM_080476
  The sequence shown below is from the reference sequence of NM_080476. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCTCGTGCTCAAGTAGGCCTGGCTGGCACAGGGCTGCATGGACCTCAGGGGGCTGTGGGGCCAGAAGCT
  GGGCCAAGCCCTCCAGCCAGAGTTGCCAGCAGGCGAGTGCTTGGGCAGAAGAGGTTCGAGTCCAGGGTCA
  CAAGTCTCTGGTACCAAAAGGGACCCATGGCTGACTGACAGCAAGGCCTATGGGGAAGAACTGGGAGCTC
  CCCAACTTGGACCCCCACCTTGTGGCTCTGCACACCAAGGAGCCCCCTCCCAGACAGGAAGGAGAAGAGG
  CAGGTGAGCAGGGCTTGTTAGATTGTGGCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_080476.4
• Summary: The protein encoded by this gene shares similarity with Saccharomyces cerevisiae Cdc91, a predicted integral membrane protein that may function in cell division control. The protein encoded by this gene is the fifth subunit of GPI transamidase that attaches GPI-anchors to proteins. [provided by RefSeq, Jul 2008]
• Locus ID: 128869